This product has been added to your favorites list. Go to My Favorites

System Message

OKCancel
LOADING ...
  • Home
  • › Search Tool
  • › Search Results
  • › C___3084793_20
See other APOC1 GT Assays ›
SNP ID:
rs429358
Gene
APOC1 APOE TOMM40
Gene Name
apolipoprotein C1
apolipoprotein E
translocase of outer mitochondrial membrane 40
Set Membership:
> HapMap
Chromosome Location:
Chr.19: 44908684 - 44908684 on Build GRCh38
Polymorphism:
C/T, Transition substitution
Context Sequence [VIC/FAM]:

GCTGGGCGCGGACATGGAGGACGTG[C/T]GCGGCCGCCTGGTGCAGTACCGCGG

Assay ID C___3084793_20
Size
Availability Made To Order
Catalog # 4351379
Price
Your Price
Online offer:
Check your price ›
  • Genomic Map
  • Assay Details
  • More Information

Genomic Map

LOADING...
×
Back To Top

Assay Details



Species:

Human

dbSNP Submissions:

NA

Phenotype:

MIM: 107710 MIM: 107741 MIM: 608061

Literature Links:

APOC1 PubMed Links

Allele Nomenclature:

Minor Allele Frequency:

1000Genome Applied Biosystems® HapMap
Global
C (0.15)
(0.85)
Caucasian - Not Available CEPH (CEU) - Not Available
EAS
C (0.09)
(0.91)
African American - Not Available YRI (Yoruba)
C (0.02)
(0.98)
SAS
C (0.09)
(0.91)
Chinese - Not Available CHB (Han Chinese) - Not Available
AFR
C (0.27)
(0.73)
Japanese - Not Available JPT (Japanese)
C (0.01)
(0.99)
EUR
C (0.16)
(0.84)
AMR
C (0.10)
(0.90)
APOC1 - apolipoprotein C1
There are no transcripts associated with this gene.
APOE - apolipoprotein E
Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
NM_000041.3 586 Missense Mutation CGC,TGC R,C 130 NP_000032.1
NM_001302688.1 586 Missense Mutation CGC,TGC R,C 156 NP_001289617.1
NM_001302689.1 586 Missense Mutation CGC,TGC R,C 130 NP_001289618.1
NM_001302690.1 586 Missense Mutation CGC,TGC R,C 130 NP_001289619.1
NM_001302691.1 586 Missense Mutation CGC,TGC R,C 130 NP_001289620.1
TOMM40 - translocase of outer mitochondrial membrane 40
There are no transcripts associated with this gene.

Back To Top

More Information


Set Membership:

HapMap

Panther Classification:

Molecular Function -

apolipoprotein

Gene Ontology Categories:

Function(s) Process(es)

response to reactive oxygen species
retinoid metabolic process
negative regulation of endothelial cell proliferation
response to dietary excess
triglyceride metabolic process
cholesterol catabolic process
cellular calcium ion homeostasis
receptor-mediated endocytosis
cytoskeleton organization
G-protein coupled receptor signaling pathway
nitric oxide mediated signal transduction
synaptic transmission, cholinergic
cholesterol metabolic process
regulation of gene expression
negative regulation of platelet activation
positive regulation of cholesterol esterification
positive regulation of cholesterol efflux
long-chain fatty acid transport
protein import
virion assembly
triglyceride catabolic process
cGMP-mediated signaling
negative regulation of blood coagulation
regulation of axon extension
positive regulation of cGMP biosynthetic process
neuron projection regeneration
regulation of Cdc42 protein signal transduction
positive regulation of low-density lipoprotein particle receptor catabolic process
cholesterol efflux
phospholipid efflux
very-low-density lipoprotein particle remodeling
low-density lipoprotein particle remodeling
high-density lipoprotein particle remodeling
high-density lipoprotein particle assembly
chylomicron remnant clearance
high-density lipoprotein particle clearance
very-low-density lipoprotein particle clearance
lipoprotein metabolic process
lipoprotein biosynthetic process
lipoprotein catabolic process
vasodilation
cholesterol homeostasis
negative regulation of MAP kinase activity
negative regulation of neuron apoptotic process
negative regulation of blood vessel endothelial cell migration
reverse cholesterol transport
positive regulation by host of viral process
negative regulation of cholesterol biosynthetic process
positive regulation of lipid biosynthetic process
intracellular transport
regulation of neuronal synaptic plasticity
artery morphogenesis
negative regulation of inflammatory response
positive regulation of nitric-oxide synthase activity
positive regulation of membrane protein ectodomain proteolysis
maintenance of location in cell
fatty acid homeostasis
positive regulation of dendritic spine development
negative regulation of canonical Wnt signaling pathway
AMPA glutamate receptor clustering
NMDA glutamate receptor clustering
cellular oxidant detoxification
regulation of beta-amyloid clearance
negative regulation of neuron death
positive regulation of postsynaptic membrane organization
negative regulation of presynaptic membrane organization
negative regulation of beta-amyloid formation
positive regulation of dendritic spine maintenance
positive regulation of phospholipid efflux
positive regulation of lipid transport across blood brain barrier
beta-amyloid binding
lipid transporter activity
protein binding
phospholipid binding
heparin binding
lipid binding
cholesterol binding
antioxidant activity
cholesterol transporter activity
identical protein binding
protein homodimerization activity
metal chelating activity
tau protein binding
low-density lipoprotein particle receptor binding
phosphatidylcholine-sterol O-acyltransferase activator activity
very-low-density lipoprotein particle receptor binding
lipoprotein particle binding

Back To Top

Related Products

  • TaqMan® Genotyping Master Mix

Your items have has been added!


Host server : magellan-search-67c57db967-gkpsr:80/100.66.129.86:80.
git-commit: 6490ebef70c169f16309010ff0ce0a5dd7c45367
git-url: https://github.com/thermofisher/magellan-search
git-branch: release/2.36.0-2025.09.99-1.0