This product has been added to your favorites list. Go to My Favorites

System Message

OKCancel
LOADING ...
  • Home
  • › Search Tool
  • › Search Results
  • › C___2403545_10
See other TP53 GT Assays ›
SNP ID:
rs1042522
Gene
TP53 WRAP53
Gene Name
tumor protein p53
WD repeat containing antisense to TP53
Set Membership:
> HapMap
Chromosome Location:
Chr.17: 7676154 - 7676154 on Build GRCh38
Polymorphism:
C/G, Transversion substitution
Context Sequence [VIC/FAM]:

AGGAGCTGCTGGTGCAGGGGCCACG[C/G]GGGGAGCAGCCTCTGGCATTCTGGG

Assay ID C___2403545_10
Size
Availability Made To Order
Catalog # 4351379
Price
Your Price
Online offer:
Check your price ›
  • Genomic Map
  • Assay Details
  • More Information

Genomic Map

LOADING...
×
Back To Top

Assay Details



Species:

Human

dbSNP Submissions:

NA

Phenotype:

MIM: 191170 MIM: 612661

Literature Links:

TP53 PubMed Links

Allele Nomenclature:

Minor Allele Frequency:

1000Genome Applied Biosystems® HapMap
Global
C (0.46)
(0.54)
Caucasian - Not Available CEPH (CEU)
C (0.23)
(0.77)
EAS
G (0.41)
(0.59)
African American - Not Available YRI (Yoruba)
G (0.33)
(0.67)
SAS
G (0.49)
(0.51)
Chinese - Not Available JPT (Japanese)
C (0.41)
(0.59)
AFR
C (0.33)
(0.67)
Japanese - Not Available CHB (Han Chinese)
G (0.49)
(0.51)
EUR
G (0.29)
(0.71)
AMR
C (0.32)
(0.68)
TP53 - tumor protein p53
Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
NM_000546.5 417 Missense Mutation CCC,CGC P,R 72 NP_000537.3
NM_001126112.2 417 Missense Mutation CCC,CGC P,R 72 NP_001119584.1
NM_001126113.2 417 Missense Mutation CCC,CGC P,R 72 NP_001119585.1
NM_001126114.2 417 Missense Mutation CCC,CGC P,R 72 NP_001119586.1
NM_001126115.1 417 Intron NP_001119587.1
NM_001126116.1 417 Intron NP_001119588.1
NM_001126117.1 417 Intron NP_001119589.1
NM_001126118.1 417 Missense Mutation CCC,CGC P,R 33 NP_001119590.1
NM_001276695.1 417 Missense Mutation CCC,CGC P,R 33 NP_001263624.1
NM_001276696.1 417 Missense Mutation CCC,CGC P,R 33 NP_001263625.1
NM_001276697.1 417 Intron NP_001263626.1
NM_001276698.1 417 Intron NP_001263627.1
NM_001276699.1 417 Intron NP_001263628.1
NM_001276760.1 417 Missense Mutation CCC,CGC P,R 33 NP_001263689.1
NM_001276761.1 417 Missense Mutation CCC,CGC P,R 33 NP_001263690.1
WRAP53 - WD repeat containing antisense to TP53
There are no transcripts associated with this gene.

Back To Top

More Information


Set Membership:

HapMap

Panther Classification:

Molecular Function -

P53-like transcription factor

Gene Ontology Categories:

Function(s) Process(es)

negative regulation of transcription from RNA polymerase II promoter
DNA strand renaturation
base-excision repair
nucleotide-excision repair
regulation of transcription, DNA-templated
transcription from RNA polymerase II promoter
protein complex assembly
cellular response to DNA damage stimulus
DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest
DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator
ER overload response
cell cycle arrest
Ras protein signal transduction
multicellular organism development
cell aging
protein localization
cell proliferation
negative regulation of cell proliferation
determination of adult lifespan
response to X-ray
response to gamma radiation
positive regulation of gene expression
viral process
protein sumoylation
cell differentiation
negative regulation of cell growth
DNA damage response, signal transduction by p53 class mediator
positive regulation of histone deacetylation
chromatin assembly
mitotic G1 DNA damage checkpoint
positive regulation of protein oligomerization
cellular response to UV
cellular response to drug
cellular response to glucose starvation
intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator
regulation of apoptotic process
positive regulation of apoptotic process
negative regulation of apoptotic process
entrainment of circadian clock by photoperiod
proteasome-mediated ubiquitin-dependent protein catabolic process
positive regulation of neuron apoptotic process
negative regulation of transcription, DNA-templated
positive regulation of transcription, DNA-templated
positive regulation of transcription from RNA polymerase II promoter
response to antibiotic
positive regulation of protein export from nucleus
regulation of mitochondrial membrane permeability
negative regulation of fibroblast proliferation
circadian behavior
positive regulation of peptidyl-tyrosine phosphorylation
negative regulation of helicase activity
protein tetramerization
negative regulation of telomerase activity
positive regulation of thymocyte apoptotic process
positive regulation of cell cycle arrest
cellular response to hypoxia
cellular response to ionizing radiation
intrinsic apoptotic signaling pathway by p53 class mediator
positive regulation of release of cytochrome c from mitochondria
replicative senescence
oxidative stress-induced premature senescence
intrinsic apoptotic signaling pathway
oligodendrocyte apoptotic process
positive regulation of execution phase of apoptosis
positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway
regulation of signal transduction by p53 class mediator
regulation of cell cycle G2/M phase transition
positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress
positive regulation of reactive oxygen species metabolic process
positive regulation of intrinsic apoptotic signaling pathway
RNA polymerase II transcription factor activity, sequence-specific DNA binding
core promoter sequence-specific DNA binding
RNA polymerase II transcription factor binding
transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific binding
protease binding
p53 binding
DNA binding
chromatin binding
damaged DNA binding
double-stranded DNA binding
transcription factor activity, sequence-specific DNA binding
copper ion binding
protein binding
ATP binding
transcription factor binding
zinc ion binding
enzyme binding
protein kinase binding
protein phosphatase binding
receptor tyrosine kinase binding
ubiquitin protein ligase binding
histone acetyltransferase binding
identical protein binding
sequence-specific DNA binding
protein self-association
transcription regulatory region DNA binding
protein heterodimerization activity
protein N-terminus binding
chaperone binding
protein phosphatase 2A binding

Back To Top

Related Products

  • TaqMan® Genotyping Master Mix

Your items have has been added!


Host server : magellan-search-67c57db967-gkpsr:80/100.66.129.86:80.
git-commit: 6490ebef70c169f16309010ff0ce0a5dd7c45367
git-url: https://github.com/thermofisher/magellan-search
git-branch: release/2.36.0-2025.09.99-1.0