This product has been added to your favorites list. Go to My Favorites

System Message

OKCancel
LOADING ...
  • Home
  • › Search Tool
  • › Search Results
  • › C__29347861_10
See other TCF7L2 GT Assays ›
SNP ID:
rs7903146
Gene
TCF7L2
Gene Name
transcription factor 7 like 2
Set Membership:
> HapMap
Chromosome Location:
Chr.10: 112998590 - 112998590 on Build GRCh38
Polymorphism:
C/T, Transition substitution
Context Sequence [VIC/FAM]:

TAGAGAGCTAAGCACTTTTTAGATA[C/T]TATATAATTTAATTGCCGTATGAGG

Assay ID C__29347861_10
Size
Availability Made To Order
Catalog # 4351379
Price
Your Price
Online offer:
Check your price ›
  • Genomic Map
  • Assay Details
  • More Information

Genomic Map

LOADING...
×
Back To Top

Assay Details



Species:

Human

dbSNP Submissions:

NA

Phenotype:

MIM: 602228

Literature Links:

TCF7L2 PubMed Links

Allele Nomenclature:

Minor Allele Frequency:

1000Genome Applied Biosystems® HapMap
Global
T (0.23)
(0.77)
Caucasian - Not Available CEPH (CEU)
T (0.28)
(0.72)
EAS
T (0.02)
(0.98)
African American - Not Available YRI (Yoruba)
T (0.26)
(0.74)
SAS
T (0.30)
(0.70)
Chinese - Not Available JPT (Japanese)
T (0.04)
(0.96)
AFR
T (0.26)
(0.74)
Japanese - Not Available CHB (Han Chinese)
T (0.02)
(0.98)
EUR
T (0.32)
(0.68)
AMR
T (0.24)
(0.76)
TCF7L2 - transcription factor 7 like 2
Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
NM_001146274.1 Intron NP_001139746.1
NM_001146283.1 Intron NP_001139755.1
NM_001146284.1 Intron NP_001139756.1
NM_001146285.1 Intron NP_001139757.1
NM_001146286.1 Intron NP_001139758.1
NM_001198525.1 Intron NP_001185454.1
NM_001198526.1 Intron NP_001185455.1
NM_001198527.1 Intron NP_001185456.1
NM_001198528.1 Intron NP_001185457.1
NM_001198529.1 Intron NP_001185458.1
NM_001198530.1 Intron NP_001185459.1
NM_001198531.1 Intron NP_001185460.1
NM_030756.4 Intron NP_110383.2
XM_005270071.1 Intron XP_005270128.1
XM_005270075.1 Intron XP_005270132.1
XM_005270077.1 Intron XP_005270134.1
XM_005270078.1 Intron XP_005270135.1
XM_005270079.1 Intron XP_005270136.1
XM_005270080.1 Intron XP_005270137.1
XM_005270084.1 Intron XP_005270141.1
XM_005270085.1 Intron XP_005270142.1
XM_005270086.1 Intron XP_005270143.1
XM_005270088.1 Intron XP_005270145.1
XM_005270089.1 Intron XP_005270146.1
XM_005270091.2 Intron XP_005270148.1
XM_005270092.1 Intron XP_005270149.1
XM_005270093.2 Intron XP_005270150.1
XM_005270094.2 Intron XP_005270151.1
XM_005270095.1 Intron XP_005270152.1
XM_005270096.2 Intron XP_005270153.1
XM_005270100.1 Intron XP_005270157.1
XM_005270101.2 Intron XP_005270158.1
XM_005270102.1 Intron XP_005270159.1
XM_005270103.1 Intron XP_005270160.1
XM_005270104.1 Intron XP_005270161.1
XM_011540109.1 Intron XP_011538411.1
XM_011540110.1 Intron XP_011538412.1
XM_011540111.1 Intron XP_011538413.1
XM_011540113.2 Intron XP_011538415.1
XM_011540116.1 Intron XP_011538418.1
XM_017016584.1 Intron XP_016872073.1
XM_017016585.1 Intron XP_016872074.1
XM_017016586.1 Intron XP_016872075.1
XM_017016587.1 Intron XP_016872076.1
XM_017016588.1 Intron XP_016872077.1
XM_017016589.1 Intron XP_016872078.1
XM_017016590.1 Intron XP_016872079.1
XM_017016591.1 Intron XP_016872080.1
XM_017016592.1 Intron XP_016872081.1
XM_017016593.1 Intron XP_016872082.1
XM_017016594.1 Intron XP_016872083.1
XM_017016595.1 Intron XP_016872084.1
XM_017016596.1 Intron XP_016872085.1

Back To Top

More Information


Set Membership:

HapMap

Panther Classification:

Molecular Function -

DNA-binding transcription factor

Gene Ontology Categories:

Function(s) Process(es)

negative regulation of transcription from RNA polymerase II promoter
blood vessel development
transcription, DNA-templated
regulation of transcription from RNA polymerase II promoter
cell cycle arrest
Wnt signaling pathway, calcium modulating pathway
cell proliferation
response to glucose
positive regulation of heparan sulfate proteoglycan biosynthetic process
pancreas development
positive regulation of insulin secretion
positive regulation of protein binding
regulation of hormone metabolic process
glucose homeostasis
negative regulation of sequence-specific DNA binding transcription factor activity
maintenance of DNA repeat elements
canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition
fat cell differentiation
negative regulation of transcription, DNA-templated
positive regulation of transcription from RNA polymerase II promoter
positive regulation of protein export from nucleus
myoblast fate commitment
regulation of smooth muscle cell proliferation
positive regulation of protein kinase B signaling
canonical Wnt signaling pathway
negative regulation of canonical Wnt signaling pathway
beta-catenin-TCF complex assembly
negative regulation of type B pancreatic cell apoptotic process
negative regulation of extrinsic apoptotic signaling pathway
RNA polymerase II core promoter proximal region sequence-specific DNA binding
RNA polymerase II repressing transcription factor binding
transcription factor activity, sequence-specific DNA binding
protein binding
beta-catenin binding
transcription factor binding
protein kinase binding
nuclear hormone receptor binding
sequence-specific DNA binding
transcription regulatory region DNA binding
gamma-catenin binding
armadillo repeat domain binding

Back To Top

Related Products

  • TaqMan® Genotyping Master Mix

Your items have has been added!


Host server : magellan-search-5c69d76d75-pfrg2:80/100.66.135.80:80.
git-commit: 261285cf70483950061b29b455a88d65ecd945f9
git-url: https://github.com/thermofisher/magellan-search
git-branch: release/2.36.1-2025.09.37-1.0